SapI from New England Biolabs

Product Specs
ItemSapI
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberR0569S
Quantity250 units
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeRestriction Enzyme
Temperature-20 C

Sequence

GCTCTTC(1/4)

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Diversity of bacterial small RNAs drives competitive strategies for a mutual chaperoneNature CommunicationsDecember 1, 2022Jorjethe Roca, Andrew Santiago-Frangos, Sarah A. WoodsonpET21b-EcHfq-CAvi was amplified with primer set 2 (Supplementary Table 13), digested with SapI (NEB, R0569S) and subcloned into SapI-digested pD871 plasmid (Atum), to generate pD871-EcHfq-CAvi. A comparable plasmid

(2) Assembly of plant virus agroinfectious clones using biological material or DNA synthesisSTAR ProtocolsDecember 1, 2022Fabio Pasindigestion-ligation using AarI, its isoschizomer PaqCI® (cat. no. R0745S, New England Biolabs), or SapI (cat. no. R0569S, New England Biolabs) (Figure 1).Note: Correct assemblies using up to 24 and 13 fragments have been

(3) SCON-a Short Conditional intrON for conditional knockout with one-step zygote injectionExperimental & molecular medicineDecember 1, 2022Wu SS, Lee H, Szép-Bakonyi R, Colozza G, Boese A, Gert KR, Hallay N, Lee JH, Kim J, Zhu Y, et al.variant fragments containing the respective complementary ends were then inserted into eGFP with SapI (R0569S, NEB) and T4 ligase during 20 cycles of 2 min at 37 °C and 5 min at 16 °C, followed by 15 min at 37

(4) Restoration of the GTPase activity and cellular interactions of Gα(o) mutants by Zn(2+) in GNAO1 encephalopathy modelsScience advancesOctober 7, 2022Larasati YA, Savitsky M, Koval A, Solis GP, Valnohova J, Katanaev VL.University, Sweden), which was digested with Bbs I and Sap I (New England Biolabs, catalog nos. R0539S and R0569S). The resultant plasmid pDUAL-L1R2 contains two guide RNAs (gRNAs) for induction of double-strand breaks

(5) Somatic Genetics Analysis of Sleep in Adult MiceThe Journal of NeuroscienceJuly 13, 2022Guodong Wang et al.2014; Sunagawa et al., 2016). Annealed oligos for individual sgRNA were first inserted into the SapI (R0569S, NEB) digested pAAV-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH (Addgene, 60231) vector. To better construct

(6) An in-library ligation strategy and its application in CRISPR/Cas9 screening of high-order gRNA combinationsNucleic Acids ResearchJune 24, 2022Zhike Lu et al.Cutsmart Buffer (NEB, B7204), 2 ul BbsI-HF (NEB, R3539L) for the in vitro screening library or 2 ul SapI (NEB, R0569S) for the in vivo screening library, 0.5 ul ATP (Thermo, R0441), 0.5 ul DTT (Invitrogen, Y00147), and

(7) Ir56b is an atypical ionotropic receptor that underlies appetitive salt response in DrosophilaCurrent BiologyApril 1, 2022Hany K.M. Dweck, Gaëlle J.S. Talross, Yichen Luo, Shimaa A. M. Ebrahim, John R. CarlsonR0101S XbaI,New England BioLabs,Cat# R0145S NdeI,New England BioLabs,Cat# R0111S SapI,New England BioLabs,Cat# R0569S Gibson assembly,New England BioLabs,Cat# E5510S Q5,New England BioLabs,Cat# M0543S Q5 site-directed mutagenesis kit

(8) High throughput screening identifies SOX2 as a super pioneer factor that inhibits DNA methylation maintenance at its binding sitesNature CommunicationsDecember 1, 2021Ludovica Vanzan, Hadrien Soldati, Victor Ythier, Santosh Anand, Simon M. G. Braun, Nicole Francis, Rabih Murrfollows13: 4 × 106 cells were transfected with 100 µg of the pZRMCE plasmid linearized with SapI (NEB, R0569S) using the NucleofectorTM 2b device and the Mouse ES Cell NucleofectorTM Kit (Lonza, VAPH-1001). The

(9) An Agrobacterium ‐mediated stable transformation technique for the hornwort model Anthoceros agrestisNew PhytologistNovember 1, 2021Eftychios Frangedakis et al.μl 10 mM ATP (P0756S; NEB), 0.25 μl 400 U μl−1 T4 DNA ligase (M0202S; NEB), 0.25 μl 10 U μl−1 SapI (R0569S; NEB), 1 μl of L0 DNA part, and 1 μl of pUAP4) to clone the amplified DNA part into pUAP4. Samples were

(10) Arrayed CRISPRi and quantitative imaging describe the morphotypic landscape of essential mycobacterial geneseLifeNovember 6, 2020Timothy J de Wet, Kristy R Winkler, Musa Mhlanga, Valerie Mizrahi, Digby F Warnerkit Qiagen 28106 Commercial assay or kit T4 Ligase NEB NEB M0202M Commercial assay or kit SapI NEB NEB R0569S Chemical compound, drug See Supplementary file 1 Software algorithm FIJI Schindelin et al., 2012 Software algorithm MicrobeJ Ducret

(11) Humanization of Drosophila Gαo to Model GNAO1 Paediatric EncephalopathiesBiomedicinesOctober 6, 2020Mikhail Savitsky, Gonzalo P. Solis, Mikhail Kryuchkov, Vladimir L. Katanaevamplified, respectively, were mixed with pHD-ScarlessDsRed pre-digested with SapI (New England Biolabs, cat #R0569S) and AarI (Thermo Fisher Scientific, Waltham. MA, USA, cat. #ER1581) restriction enzymes and circulated

(12) Multiplexed primer extension sequencing: A targeted RNA-seq method that enables high-precision quantitation of mRNA splicing isoforms and rare pre-mRNA splicing intermediatesMethodsApril 1, 2020Michael A. Gildea, Zachary W. Dwyer, Jeffrey A. PleissSciences, DMSO,100%,, dNTP mix,"10 mM each (dATP, dGTP, dCTP, dTTP)",, Sap1 restriction enzyme,,NEB,R0569S Cutsmart buffer,10x,NEB,R0569S Lambda exonuclease,,NEB,M0262S Lambda exonuclease buffer,10x,NEB,M0262S Isopropanol,100%,, Ethanol,70%,, Sodium

(13) Cell-type-specific dysregulation of RNA alternative splicing in short tandem repeat mouse knockin models of myotonic dystrophyGenes & DevelopmentDecember 1, 2019Curtis A. Nutter, Jodi L. Bubenik, Ruan Oliveira, Franjo Ivankovic, Åukasz J. Sznajder, Benjamin M. Kidd, Belinda S. Pinto, Brittney A. Otero, Helmut A. Carter, Eric A. Vitriol, Eric T. Wang, Maurice S. Swanson

(14) Glutamate Signaling in Hepatic Stellate Cells Drives Alcoholic SteatosisCell metabolismNovember 5, 2019Choi WM, Kim HH, Kim MH, Cinar R, Yi HS, Eun HS, Kim SH, Choi YJ, Lee YS, Kim SY, et al.hydrochloride,Tocris,Cat#0923 Rosewell Park Memorial Institute (RPMI)-1640,Welgene,Cat#:LM011–01 Sapl,New England BioLabs,Cat#:R0569S Sulfasalazine,Sigma-Aldrich,Cat#:S0883 Triton X-100,Sigma-Aldrich,Cat#:T9284 Tween 20,Sigma-Aldrich,Cat#:P1379 TRIzol reagent

(15) High-resolution and high-accuracy topographic and transcriptional maps of the nucleosome barriereLifeJuly 31, 2019Zhijie Chen, Ronen Gabizon, Aidan I Brown, Antony Lee, Aixin Song, César Díaz-Celis, Craig D Kaplan, Elena F Koslover, Tingting Yao, Carlos Bustamantekit,BglI,NEB,Cat# R0143S, Commercial assay or kit,EagI-HF,NEB,Cat# R3505S, Commercial assay or kit,SapI,NEB,Cat# R0569S, Sequence-based reagent,Lambda DNA,NEB,Cat# N3011S, Recombinant DNA reagent,Primers for making constructs

(16) The influenza virus hemagglutinin head evolves faster than the stalk domainScientific reportsJuly 11, 2018Kirkpatrick E, Qiu X, Wilson PC, Bahl J, Krammer F.TCGACCTCCGAAGTTGGGGGGGAGCAAAAGCAGGGGAAAATAAAAACAACCAAAATGAAAGCAAAACTACTGATCCTGTTATGTGC were used. The amplified HA was then digested using SapI (New England Biolabs, R0569S) and ligated into the rescue vector pDZ. The N468S mutation in the A/Fort Monmouth/1/1947 HA was generated

(17) High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR–Cas9 in yeastNature BiotechnologyJuly 1, 2018Xiaoge Guo et al.sequences following the same Golden Gate cloning method as described above, but this time using SapI (NEB R0569S) and T4 ligase. The resulting Golden Gate reactions were then PCR purified and electroporated into 5-alpha

(18) Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloideseLifeMarch 9, 2018Samuel T Coradetti et al.CutSmart buffer (NEB, B7204S, Ipswich, MA), 2.5 ml T7 ligase (NEB, M0318L), and 2.5 ml of SapI (NEB, R0569S). We incubated the reaction at 37˚C for 5 min, then 25 cycles of 37˚C for 2 min and 20˚C for 5 min,

Be the First to Write a Review!

SapI

SapI from New England Biolabs

Description

Sequence

New England Biolabs

Citations (18)

Reviews

SapI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map